analysis increasing water content as a result of a water flow or rain or water mud co
Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc
Ngày tải lên :
23/03/2014, 13:20
... cell lysates or supernatants were analysed for Endo-H (A) or neuraminidase (B) sensitivity (A) The band at 70 kDa corresponding to immature cell associated GPV was converted into a 50 kDa band ... Strassel, C., Baas, M.J., Salamero, J., ChasserotGolaz, S., Cazenave, J.P., De La Salle, C & Lanza, F (2001) Biosynthesis and intracellular post-translational processing of normal and mutant platelet ... Immunoprecipitation and SDS/PAGE Materials and cell lines The mAbs V.1 and V.5 against GPV, ALMA.12 against GPIba, ALMA.16 against GPIX and RAM.1 against GPIbb, were developed in our laboratory [19]...
- 7
- 363
- 0
Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps
Ngày tải lên :
09/08/2014, 01:23
... transfer in the treatment of chronic articular disease Indeed, IL-1Ra gene therapy has demonstrated impressive efficacy in animal models of RA and OA, and a phase I human trial has recently confirmed ... became dramatically apparent, as were the advantages of gene transfer as a means of protein delivery In the face of continual dilution, the constitutive production of the IL-1Ra gene product was ... achieves a peak plasma concentration of only about 1.6 µg IL-1Ra/ml, and concentrations superior or equal to µg IL-1Ra/ml exist only for about 14 hours Local, intraarticular gene delivery of IL-1Ra could...
- 9
- 421
- 0
Public management as a social science or a business subject in a luận án tiến sỹ của tác giã nước ngoài liên quan đến đề tài về kiểm toán
Ngày tải lên :
02/04/2014, 00:13
... increased; water was scarce and wasted through poor management of sanitation and infrastructure; average life expectancy was declining; education outcomes are poor; safety and security was limited; and ... Finally, Ballard has played first team club rugby for five seasons and is a silver medalist for the Comrades marathon and Two Oceans ultra marathon He has completed eleven Two Oceans ultra marathons, ... Professor Harry Ballard INAUGURAL PROFESSORIAL ADDRESS Public Management as a Social Science or a Business Subject in a University of Technology INAUGURAL PROFESSORIAL ADDRESS by Professor Harry...
- 25
- 498
- 0
Testof English as a Foreign Language™ Information and Registration BULLETIN for Computer-based and Paper-based Testing pptx
Ngày tải lên :
02/04/2014, 05:20
... Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus Belgium ... 416 Afrikaans Albanian Amharic Arabic Armenian Assamese Azeri Bashkir Basque (Euskara) Belarusian Bemba Bengali Berber Bhili Bikol Bulgarian Burmese Buyi Catalan Cebuano (Visayan) Chichewa Chinese ... Indonesian Italian Japanese Javanese Kannada (Kanarese) Kanuri Kashmiri Kazakh Khmer Kikuyu Kinyarwanda Kirundi Konkani Korean Kurdish Kurukh (Oraon) Kusaiean Lao Latvian (Lettish) Lingala Lithuanian...
- 28
- 970
- 0
báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot
Ngày tải lên :
18/06/2014, 15:20
... experimental subject, collection and /or assembly of data, data analysis and interpretation, manuscript writing; TP: conception and design of the study, collection and /or assembly of data, data analysis ... data, data analysis and interpretation, manuscript writing; CA: collection and /or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript ... anticoagulant All samples were stored at a temperature of 4°C and processed within 24 h of arrival at the laboratory Blood cell count was assessed by use of an automatic cell counter (AcT-diff;...
- 6
- 426
- 0
Báo cáo y học: "Spinal cord stimulation as a treatment for refractory neuropathic pain in tethered cord syndrome: a case report ppsx
Ngày tải lên :
11/08/2014, 11:23
... analyzed data of our patient and drafted the manuscript ADS examined our patient and was the major contributor in writing the manuscript JDH performed the intra-operative testing and was a major contributor ... effectiveness of SCS in patients with TCS The implantation of a spinal cord stimulator in a patient with TCS as an effective treatment for refractory chronic neuropathic pain has not been described Page of ... electrical nerve stimulation; VAS: visual analogue scale Acknowledgements Special thanks to Professor Gabriel Moens for his editorial advice Maarten Moens is Clinical Investigator of The Research...
- 4
- 460
- 0
Reconsidering Tourism As A Facilitator For Economic Growh In Less Developed Countries
Ngày tải lên :
12/12/2016, 20:32
... indicators like Geographical Zone, Gross National Product (GNP) per capita as an indicator of General Standard of Living in a Country and Economic Classification of a country on tourism as a facilitator ... can the indicators such as Geographical zone, General Standard of living in a country (GNP) per capita and Economic Classification of a Country determine Reconsidering Tourism as a Facilitator ... factor in the balance of payment for many countries and regions and has been a major contributor to their economic growth As a natural consequence, it has become, in the last decades, a discipline...
- 93
- 236
- 0
Working as a tour guide at hoi an green travel company
Ngày tải lên :
20/02/2017, 15:17
... Translate information about Cham island and Japanese covered Bridge from Vietnamese to English Cham island The Cham Islands are off the Central Coast of Vietnam Approximately nautical miles and ... 1917 and the latest rehabilitation was done in 1986 The Japanese Bridge or Pagoda Bridge in an invaluable property and has been regarded as the symbol of the ancient town and was licensed as a Nation ... Lord (Nguyen Phuc Chu) visited Hoi An and renamed the Bridge as Lai Vien Kieu It means a bridge for passengers by from far away or a bridge was built by passengers by from far away Japanese Covered...
- 18
- 634
- 2
Cardiovascular magnetic resonance imaging in the assesment of myocardial blood flow, viability, and diffuse fibrosis in congenital and acquired heart disease
Ngày tải lên :
20/05/2016, 20:50
... intersecting the aorta at both locations at an approximately right angle Phase-contrast flow velocity measurements in the proximal ascending aorta were also used for assessment of aortic valve competence ... arteries anomalies, such as Bland-White-Garland syndrome, congenital coronary artery fistula, and aberrant main left coronary artery Page | a) Bland-White-Garland-Syndrome Anomalous origin of the LCA ... and classified by Yacoub et al in 1978 (Figure 2) Figure TGA with ventricular septal defect, coronary artery abnormalities, coarctation of the aorta as well as tricuspid and mitral valve abnormalities...
- 103
- 349
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
Ngày tải lên :
22/03/2014, 12:20
... Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score 335 ... Tri’s brackish water shrimp culture, the study considers those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of ... criteria are measured. Another disadvantage is the large amount of pairwise comparisons if many criteria exist. 2.6. Determination of alternatives Based on the constraints and objectives of ...
- 13
- 487
- 0
A contrastive analysis of encouraging as a speech act in english and vietnamese
Ngày tải lên :
26/11/2013, 13:31
... more confident Learning to perform words of encouraging in an appropriate, nativelike manner is not an easy task for learners of English as a foreign language Accordingly, we would like to have ... 2.2.3.3 Encouraging and Comforting th According to Oxford Advanced Learner’s Dictionary- edition: According to Elizabeth Walter [88], “encouraging is the act of talking or behaving in a way that gives ... [07] has created a new approach to pragmatics for Vietnamese linguists concerns of discourse studies across languages is that of setting up comparable units of analysis within the various languages...
- 13
- 1.6K
- 8
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
Ngày tải lên :
19/02/2014, 17:20
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3Â) (N ẳ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, containing ... Jlactate alas ị ẳ 0:919 129 alas ị à ð1 À eÀ6Ãalas Þ À 75:2 (User 3:3 defined), Jacetate alas ị ẳ 0:1135 30:3 alas ị e6alas ịỵ 4:66 (User dened), Jformate alas Þ ¼ 0:173 à ðÀ23:7 À alas ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified...
- 12
- 616
- 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
Ngày tải lên :
17/03/2014, 23:20
... aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic ... neurons and cardiac myocytes) for life maintenance Mitochondria are the main source of ROS formation, as well as the main target for free radical attack The accumulation of defective mitochondria within ... Martinuzzi, A. , Hurko, O & Attardi, G (1992) Marked replicative advantage of human mtDNA carrying a point mutation that causes the MELAS encephalomyopathy Proc Natl Acad Sci USA 89, 11164–11168 49 Wallace,...
- 7
- 444
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
Ngày tải lên :
23/03/2014, 05:22
... GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG ... Tau-for Tau-rev STOP-for STOP-rev Doublecortin-for Doublecortin-rev LIS1-for LIS1-rev Tubulin a6 -for Tubulin a6 -rev GAGCTGGAGCCAGTTGAGAAGCAGGG GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 92431–92404...
- 14
- 416
- 0
Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx
Ngày tải lên :
18/06/2014, 22:20
... expression (Table 3) as well as clinical data (Table 4) in studied tissues and blood was observed Discussion The critical role of circulating tumor cells in metastatic spread of carcinomas has already ... studies and performed data analysis AJ has been involved in coordination of the study and drafting the manuscript MWC, WW performed the statistical analysis and interpretation of data ENM, EG, KA collected ... surgical tissue and blood samples, performed anatomicopathologic macroscopic and microscopic examinations and delivered clinical patients’ data All authors read and accepted the final manuscript Competing...
- 9
- 460
- 0
Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part1 ppt
Ngày tải lên :
19/06/2014, 15:20
... is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This ... is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ...
- 11
- 306
- 0
Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part2 pdf
Ngày tải lên :
19/06/2014, 15:20
... is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This ... is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ...
- 11
- 282
- 0
báo cáo hóa học: " Elimination kinetics of diisocyanates after specific inhalative challenges in humans: mass spectrometry analysis, as a basis for biomonitoring strategies" doc
Ngày tải lên :
20/06/2014, 00:20
... mercapturic acid, glucoronic acid as well as acetyl-/diacetyl isocyanate diamines to corresponding MDA, HDA, TDA, NDA and IPDA For the current analysis, all patient samples, standards and controls ... Pearson PG, Han DH, Baillie TA: Biotransformation of methyl isocyanate in the rat Evidence for glutathione conjugation as a major pathway of metabolism and implications for isocyanate-mediated ... Furthermore, the measurement of isocyanate levels in air is complicated [12] by the various physical states of isocyanates, as they may occur as gases or aerosols (in particles or droplets of various sizes)...
- 8
- 433
- 0